crispr cas9 nickases Search Results


94
Genecopoeia crispr cas9 system
Crispr Cas9 System, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr cas9 system/product/Genecopoeia
Average 94 stars, based on 1 article reviews
crispr cas9 system - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Integrated DNA Technologies modification crispr cas9 nickase site specific nuclease site specific nuclease ssn delivery method alt r hifi crispr cas9 nickase system
Modification Crispr Cas9 Nickase Site Specific Nuclease Site Specific Nuclease Ssn Delivery Method Alt R Hifi Crispr Cas9 Nickase System, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/modification crispr cas9 nickase site specific nuclease site specific nuclease ssn delivery method alt r hifi crispr cas9 nickase system/product/Integrated DNA Technologies
Average 96 stars, based on 1 article reviews
modification crispr cas9 nickase site specific nuclease site specific nuclease ssn delivery method alt r hifi crispr cas9 nickase system - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology nrf2 specific crispr cas9
Nrf2 Specific Crispr Cas9, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nrf2 specific crispr cas9/product/Santa Cruz Biotechnology
Average 94 stars, based on 1 article reviews
nrf2 specific crispr cas9 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Applied Biological Materials Inc cas9 h840a nickase
Cas9 H840a Nickase, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas9 h840a nickase/product/Applied Biological Materials Inc
Average 90 stars, based on 1 article reviews
cas9 h840a nickase - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc plasmids expressing, wild type cas9, nuclease null cas9 cas9 nickase
Plasmids Expressing, Wild Type Cas9, Nuclease Null Cas9 Cas9 Nickase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmids expressing, wild type cas9, nuclease null cas9 cas9 nickase/product/Addgene inc
Average 90 stars, based on 1 article reviews
plasmids expressing, wild type cas9, nuclease null cas9 cas9 nickase - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology nickase plasmid
Effect of septin depletion in MFE296 cells. ( A ) Transient knockdown of septin-2 and -7 by siRNAs. ( B ) <t>Septin-7</t> <t>knockout</t> using the CRISPR/Cas9 system. Cells were transfected with control or septin-7 double <t>nickase</t> plasmid. Following puromycin selection, polyclonal cells were treated with DMSO or FCF (100 μM, 6 h) and subject to immunoblotting with indicated antibodies. ( C ) Effect of FCF on OCR and ECAR in septin depleted cells. Wild-type MFE296 or single cell derived septin-7 knockout was transfected with siRNAs as indicated. After 48 h, cells were split into 96-well plates (for Seahorse analysis) or 6-well plates (for immunoblotting) and allowed to adhere overnight. Afterwards, expression of septins was analyzed by immunoblotting with specific antibodies to each septins (left), or OCR and ECAR were monitored following DMSO or FCF (100 µM) treatment. y -axis: changes after DMSO or FCF injection (right). (*: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001)
Nickase Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nickase plasmid/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
nickase plasmid - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
TriLink cas9 nickase mrna l-6116
(A) SIRT3 deacetylase assays were performed by incubating purified, recombinant SIRT3 (0.5 μg) with acetylated substrate, NAD+ and Pnc1. Deacetylase activity was monitored by measuring nicotinamide production after reaction with ortho-pthalaldehyde. (B) HeLa cells were treated with 10 μM CCCP (+) or DMSO control (−) for 10 min. Then, cells were lysed, and acetyl-proteins were immunoprecipitated using α-AcK antibodies. Immunoprecipitates were separated by SDS-PAGE and analyzed by Western blotting with α-OGDH, α-SIRT3, and α-GLUD1 antibodies. 1:100 of the lysate was loaded for input controls. (C) SIRT3 knockdown HeLa cells were treated −/+ CCCP and analyzed as described for panel B. (D) Purified HeLa cell mitochondria were treated with 10 μM CCCP or DMSO control for 10 min in K-Pi buffer containing succinate, glutamate and malate. Mitochondria were lysed, separated by SDS-PAGE, and analyzed by Western blotting with α-AcK and α-porin antibodies. Porin was used as loading control. (E–F) Mitochondria isolated from wildtype and SIRT3−/− mouse hearts were treated with indicated concentrations of CCCP or DMSO control for 10 min in K-Pi buffer containing succinate, glutamate and malate. Mitochondria were lysed, separated by SDS-PAGE, and acetylation was assessed as for panel D. (F) Acetylation was quantified using ImageJ. ** indicates p-value < 0.01 (3 biological repeats/genotype). (G) MEFs were treated with 10 μM CCCP, 1 μM of rotenone and antimycin A. Fat oxidation assays were performed in basal growth medium containing labeled palmitic acid for 30 min. Released 3H2O was measured and normalized to protein content. n = 2 experiments. (p<0.01). (H) Representative microscope images of membrane potential in SIRT3 inducible knockdown HeLa cells (shSIRT3) and shRNA scramble control HeLa cells treated with 0.2 μM CCCP for 5 minutes. The TMRM signal was monitored and compared with mitochondrial staining by Mitotracker Green. n=4–5 individual experiments. (I) Representative quantification of depletion and recovery of TMRM signal in SIRT3 scramble shRNA control (blue line) or SIRT3-inducible knockdown (shSIRT3, red line) HeLa cells (from panel H). Pictures were taken every 30 sec, mitochondria were detected by Mitotracker Green, and mean value of TMRM signal was calculated using ImageJ. (J–L) TMRM recovery rates collected from 30–40 cells/group demonstrates a significant difference between SIRT3 scramble shRNA control or shSIRT3 HeLa cells (J); TMRM recovery rates in HeLa cells which were transfected with ATP5O siRNA, and then siRNA resistant variants of wildtype ATP5O H135E ATP5O were overexpressed (K); TMRM recovery in H135E ATP5O <t>Crispr/Cas9</t> heterozygous cells or control HeLa cells (p=0.03). n=3–5 individual experiments. (M) Model of membrane potential regulation of SIRT3 activity through its binding with ATP synthase. In healthy cells with intact mitochondrial membrane potential, SIRT3 binds to ATP synthase. In conditions of disrupted membrane potential and low matrix pH, SIRT3 dissociates from ATP synthase and binds to other targets, which promote restoration of mitochondrial membrane potential. See Figure S7
Cas9 Nickase Mrna L 6116, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas9 nickase mrna l-6116/product/TriLink
Average 90 stars, based on 1 article reviews
cas9 nickase mrna l-6116 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc cas9 (d10a) nickase plasmids
KEY RESOURCES TABLE
Cas9 (D10a) Nickase Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas9 (d10a) nickase plasmids/product/Addgene inc
Average 90 stars, based on 1 article reviews
cas9 (d10a) nickase plasmids - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc plasmid pspcas9n (bb)-2a-gfp (px461)
KEY RESOURCES TABLE
Plasmid Pspcas9n (Bb) 2a Gfp (Px461), supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid pspcas9n (bb)-2a-gfp (px461)/product/Addgene inc
Average 90 stars, based on 1 article reviews
plasmid pspcas9n (bb)-2a-gfp (px461) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology nickase crispr cas9 plasmid
KEY RESOURCES TABLE
Nickase Crispr Cas9 Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nickase crispr cas9 plasmid/product/Santa Cruz Biotechnology
Average 94 stars, based on 1 article reviews
nickase crispr cas9 plasmid - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology mouse mtor crispr cas9 double nickase plasmids
KEY RESOURCES TABLE
Mouse Mtor Crispr Cas9 Double Nickase Plasmids, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse mtor crispr cas9 double nickase plasmids/product/Santa Cruz Biotechnology
Average 92 stars, based on 1 article reviews
mouse mtor crispr cas9 double nickase plasmids - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology human gpc1 targeted crispr cas9 knockout plasmids crispr cas9gpc1
KEY RESOURCES TABLE
Human Gpc1 Targeted Crispr Cas9 Knockout Plasmids Crispr Cas9gpc1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human gpc1 targeted crispr cas9 knockout plasmids crispr cas9gpc1/product/Santa Cruz Biotechnology
Average 92 stars, based on 1 article reviews
human gpc1 targeted crispr cas9 knockout plasmids crispr cas9gpc1 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

Image Search Results


Effect of septin depletion in MFE296 cells. ( A ) Transient knockdown of septin-2 and -7 by siRNAs. ( B ) Septin-7 knockout using the CRISPR/Cas9 system. Cells were transfected with control or septin-7 double nickase plasmid. Following puromycin selection, polyclonal cells were treated with DMSO or FCF (100 μM, 6 h) and subject to immunoblotting with indicated antibodies. ( C ) Effect of FCF on OCR and ECAR in septin depleted cells. Wild-type MFE296 or single cell derived septin-7 knockout was transfected with siRNAs as indicated. After 48 h, cells were split into 96-well plates (for Seahorse analysis) or 6-well plates (for immunoblotting) and allowed to adhere overnight. Afterwards, expression of septins was analyzed by immunoblotting with specific antibodies to each septins (left), or OCR and ECAR were monitored following DMSO or FCF (100 µM) treatment. y -axis: changes after DMSO or FCF injection (right). (*: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001)

Journal: Cancers

Article Title: Forchlorfenuron-Induced Mitochondrial Respiration Inhibition and Metabolic Shifts in Endometrial Cancer

doi: 10.3390/cancers16050976

Figure Lengend Snippet: Effect of septin depletion in MFE296 cells. ( A ) Transient knockdown of septin-2 and -7 by siRNAs. ( B ) Septin-7 knockout using the CRISPR/Cas9 system. Cells were transfected with control or septin-7 double nickase plasmid. Following puromycin selection, polyclonal cells were treated with DMSO or FCF (100 μM, 6 h) and subject to immunoblotting with indicated antibodies. ( C ) Effect of FCF on OCR and ECAR in septin depleted cells. Wild-type MFE296 or single cell derived septin-7 knockout was transfected with siRNAs as indicated. After 48 h, cells were split into 96-well plates (for Seahorse analysis) or 6-well plates (for immunoblotting) and allowed to adhere overnight. Afterwards, expression of septins was analyzed by immunoblotting with specific antibodies to each septins (left), or OCR and ECAR were monitored following DMSO or FCF (100 µM) treatment. y -axis: changes after DMSO or FCF injection (right). (*: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001)

Article Snippet: To establish a stable knockout of septin-7, MFE296 cells were transfected with septin-7 Double Nickase plasmid (Santa Cruz Biotechnology, sc-401655) and were selected under puromycin pressure (1.0 μg/mL) for 1–2 weeks.

Techniques: Knockdown, Knock-Out, CRISPR, Transfection, Control, Plasmid Preparation, Selection, Western Blot, Derivative Assay, Expressing, Injection

(A) SIRT3 deacetylase assays were performed by incubating purified, recombinant SIRT3 (0.5 μg) with acetylated substrate, NAD+ and Pnc1. Deacetylase activity was monitored by measuring nicotinamide production after reaction with ortho-pthalaldehyde. (B) HeLa cells were treated with 10 μM CCCP (+) or DMSO control (−) for 10 min. Then, cells were lysed, and acetyl-proteins were immunoprecipitated using α-AcK antibodies. Immunoprecipitates were separated by SDS-PAGE and analyzed by Western blotting with α-OGDH, α-SIRT3, and α-GLUD1 antibodies. 1:100 of the lysate was loaded for input controls. (C) SIRT3 knockdown HeLa cells were treated −/+ CCCP and analyzed as described for panel B. (D) Purified HeLa cell mitochondria were treated with 10 μM CCCP or DMSO control for 10 min in K-Pi buffer containing succinate, glutamate and malate. Mitochondria were lysed, separated by SDS-PAGE, and analyzed by Western blotting with α-AcK and α-porin antibodies. Porin was used as loading control. (E–F) Mitochondria isolated from wildtype and SIRT3−/− mouse hearts were treated with indicated concentrations of CCCP or DMSO control for 10 min in K-Pi buffer containing succinate, glutamate and malate. Mitochondria were lysed, separated by SDS-PAGE, and acetylation was assessed as for panel D. (F) Acetylation was quantified using ImageJ. ** indicates p-value < 0.01 (3 biological repeats/genotype). (G) MEFs were treated with 10 μM CCCP, 1 μM of rotenone and antimycin A. Fat oxidation assays were performed in basal growth medium containing labeled palmitic acid for 30 min. Released 3H2O was measured and normalized to protein content. n = 2 experiments. (p<0.01). (H) Representative microscope images of membrane potential in SIRT3 inducible knockdown HeLa cells (shSIRT3) and shRNA scramble control HeLa cells treated with 0.2 μM CCCP for 5 minutes. The TMRM signal was monitored and compared with mitochondrial staining by Mitotracker Green. n=4–5 individual experiments. (I) Representative quantification of depletion and recovery of TMRM signal in SIRT3 scramble shRNA control (blue line) or SIRT3-inducible knockdown (shSIRT3, red line) HeLa cells (from panel H). Pictures were taken every 30 sec, mitochondria were detected by Mitotracker Green, and mean value of TMRM signal was calculated using ImageJ. (J–L) TMRM recovery rates collected from 30–40 cells/group demonstrates a significant difference between SIRT3 scramble shRNA control or shSIRT3 HeLa cells (J); TMRM recovery rates in HeLa cells which were transfected with ATP5O siRNA, and then siRNA resistant variants of wildtype ATP5O H135E ATP5O were overexpressed (K); TMRM recovery in H135E ATP5O Crispr/Cas9 heterozygous cells or control HeLa cells (p=0.03). n=3–5 individual experiments. (M) Model of membrane potential regulation of SIRT3 activity through its binding with ATP synthase. In healthy cells with intact mitochondrial membrane potential, SIRT3 binds to ATP synthase. In conditions of disrupted membrane potential and low matrix pH, SIRT3 dissociates from ATP synthase and binds to other targets, which promote restoration of mitochondrial membrane potential. See Figure S7

Journal: Cell

Article Title: Mitochondrial Sirtuin Network Reveals Dynamic SIRT3-dependent Deacetylation in Response to Membrane Depolarization

doi: 10.1016/j.cell.2016.10.016

Figure Lengend Snippet: (A) SIRT3 deacetylase assays were performed by incubating purified, recombinant SIRT3 (0.5 μg) with acetylated substrate, NAD+ and Pnc1. Deacetylase activity was monitored by measuring nicotinamide production after reaction with ortho-pthalaldehyde. (B) HeLa cells were treated with 10 μM CCCP (+) or DMSO control (−) for 10 min. Then, cells were lysed, and acetyl-proteins were immunoprecipitated using α-AcK antibodies. Immunoprecipitates were separated by SDS-PAGE and analyzed by Western blotting with α-OGDH, α-SIRT3, and α-GLUD1 antibodies. 1:100 of the lysate was loaded for input controls. (C) SIRT3 knockdown HeLa cells were treated −/+ CCCP and analyzed as described for panel B. (D) Purified HeLa cell mitochondria were treated with 10 μM CCCP or DMSO control for 10 min in K-Pi buffer containing succinate, glutamate and malate. Mitochondria were lysed, separated by SDS-PAGE, and analyzed by Western blotting with α-AcK and α-porin antibodies. Porin was used as loading control. (E–F) Mitochondria isolated from wildtype and SIRT3−/− mouse hearts were treated with indicated concentrations of CCCP or DMSO control for 10 min in K-Pi buffer containing succinate, glutamate and malate. Mitochondria were lysed, separated by SDS-PAGE, and acetylation was assessed as for panel D. (F) Acetylation was quantified using ImageJ. ** indicates p-value < 0.01 (3 biological repeats/genotype). (G) MEFs were treated with 10 μM CCCP, 1 μM of rotenone and antimycin A. Fat oxidation assays were performed in basal growth medium containing labeled palmitic acid for 30 min. Released 3H2O was measured and normalized to protein content. n = 2 experiments. (p<0.01). (H) Representative microscope images of membrane potential in SIRT3 inducible knockdown HeLa cells (shSIRT3) and shRNA scramble control HeLa cells treated with 0.2 μM CCCP for 5 minutes. The TMRM signal was monitored and compared with mitochondrial staining by Mitotracker Green. n=4–5 individual experiments. (I) Representative quantification of depletion and recovery of TMRM signal in SIRT3 scramble shRNA control (blue line) or SIRT3-inducible knockdown (shSIRT3, red line) HeLa cells (from panel H). Pictures were taken every 30 sec, mitochondria were detected by Mitotracker Green, and mean value of TMRM signal was calculated using ImageJ. (J–L) TMRM recovery rates collected from 30–40 cells/group demonstrates a significant difference between SIRT3 scramble shRNA control or shSIRT3 HeLa cells (J); TMRM recovery rates in HeLa cells which were transfected with ATP5O siRNA, and then siRNA resistant variants of wildtype ATP5O H135E ATP5O were overexpressed (K); TMRM recovery in H135E ATP5O Crispr/Cas9 heterozygous cells or control HeLa cells (p=0.03). n=3–5 individual experiments. (M) Model of membrane potential regulation of SIRT3 activity through its binding with ATP synthase. In healthy cells with intact mitochondrial membrane potential, SIRT3 binds to ATP synthase. In conditions of disrupted membrane potential and low matrix pH, SIRT3 dissociates from ATP synthase and binds to other targets, which promote restoration of mitochondrial membrane potential. See Figure S7

Article Snippet: Cas9 Nickase mRNA , TriLink , L-6116.

Techniques: Histone Deacetylase Assay, Purification, Recombinant, Activity Assay, Control, Immunoprecipitation, SDS Page, Western Blot, Knockdown, Isolation, Labeling, Microscopy, Membrane, shRNA, Staining, Transfection, CRISPR, Binding Assay

Journal: Cell

Article Title: Mitochondrial Sirtuin Network Reveals Dynamic SIRT3-dependent Deacetylation in Response to Membrane Depolarization

doi: 10.1016/j.cell.2016.10.016

Figure Lengend Snippet:

Article Snippet: Cas9 Nickase mRNA , TriLink , L-6116.

Techniques: Recombinant, Modification, Sequencing, Extraction, shRNA, Software

KEY RESOURCES TABLE

Journal: Developmental cell

Article Title: Crosstalk between CLCb/Dyn1-Mediated Adaptive Clathrin-Mediated Endocytosis and Epidermal Growth Factor Receptor Signaling Increases Metastasis

doi: 10.1016/j.devcel.2017.01.007

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Cell Engineering Single CLCa H1299 and A549 cells were generated by expansion of CLCb-negative cells, as determined by Western blotting, after clonal selection by FACS sorting of single cells expressing Cas9 (D10A) nickase plasmids (Addgene plasmid #42335) harboring human CLCb guide sequence (Positive strand, 5TAGAGAACGACGAGGGCTTC3’; Negative strand, 5’CTGCAATCTCGCTC TCCTGC3’) ( Cong et al., 2013 ).

Techniques: Conjugation Assay, Transduction, Recombinant, Derivative Assay, Plasmid Preparation, Sequencing, Software, Chemotaxis Assay, Migration